دانلود رایگان مقاله لاتین جداسازی کلستریدیو در بیمار مبتلا به ورم استخوان مزمن از سایت الزویر
عنوان فارسی مقاله:
جداسازی کلستریدیوم indolis در بیمار مبتلا به ورم استخوان مزمن: گزارش و بررسی متون عفونت انسانی مربوط به گونه های گروه کلستریدیوم saccharolyticum
عنوان انگلیسی مقاله:
First isolation of Clostridium indolis in a patient with chronic osteitis: a case report and literature review of human infections related to Clostridium saccharolyticum group species
سال انتشار : 2016
برای دانلود رایگان مقاله جداسازی کلستریدیو در بیمار مبتلا به ورم استخوان مزمن اینجا کلیک نمایید.
بخشی از مقاله انگلیسی :
Gram staining showed large spore-forming Gram-variable bacilli. When subcultured on blood agar plates under anaerobic conditions two out of three samples grew with medium size mucoid colonies surrounded by a single zone of beta-hemolysis. MALDI-TOF mass spectrometry (MS) performed on the colonies by direct transfer onto target identified Clostridium indolis Log score value of 2.19 matching Clostridium indolis DSM 755T; MALDI Biotyper v2.3 (Brüker Daltonics, Bremen, Germany). This identification was confirmed by the National Reference Center of Anaerobic Bacteria and Botulism (Institut Pasteur, Paris, France) by 16S rDNA gene sequencing using forward AAGGAGGTGATCCAGCCGCA and reverse primers AGAGTTTGATCATGGCTCAG, displaying 99.6% of identity with the sequence of C. indolis type strain DSM 755T (GenBank accession number Y18184 [3]). Phylogenetic relationship between the isolated strain (Strain 570.15) and the type strain of the species is shown in Fig. 1. The tree was constructed using a neighbor-joining method (Kimura 2 parameter method) and 500 bootstraps with MEGA6 (Molecular Evolutionary Genetics Analysis version 6.0) software as previously described [4]. Values above the lines are bootstrap values expressed as percentages. Antimicrobial susceptibility testing was performed on the isolated strain by using E-test strips (bioMerieux, Marcy-l ’Etoile, France), with a McFarland 1 suspension in Schaedler broth, seeded on Brucella agar plate supplemented with vitamin K (1 mg/L) and 5% sheep blood that were incubated under anaerobic atmosphere for 48 h at 35e37 C as recommended by the Comite de l’Antibiogramme de la Societe Française de Microbiologie (CASFM) 2013 [5]. The Minimal Inhibitory Concentrations (MICs) were read following the CASFM 2013 interpretative standard for anaerobes (Table 1). To date, specific guidelines concerning the antibiotic treatment of chronic osteitis related to anaerobic bacteria do not exist. The antibiotic course was switched to oral metronidazole (500 mg t.i.d) because of its excellent oral bioavailability, good bone diffusion and because the strain was highly susceptible. The treatment was prolonged as recommended by the SPILF for a total duration of four weeks [2], in spite of potential occurrence of various side effects with prolonged metronidazole [6,7]. The patient had no secondary infections and presented no other side effects. Biological markers of inflammation returned normal at four weeks (CRP 4.1 mg/L and normal neutrophil count 2.6 G/L). In February 2016, the patient reported no pain and clinical examination showed clean scars, normal body temperature and CRP was negative. Radiological films did not show any sign of osteitis. Clostridium speci
برای دانلود رایگان مقاله جداسازی کلستریدیو در بیمار مبتلا به ورم استخوان مزمن اینجا کلیک نمایید.
کلمات کلیدی:
First isolation of Clostridium indolis in a patient with ... - Science Direct www.sciencedirect.com/science/article/pii/S1075996416300920 by R Lotte - 2016 - Cited by 1 - Related articles Clostridium indolis is an anaerobic spore-forming Gram-positive bacillus belonging ... osteitis: a case report and literature review of human infections related to Clostridium ..... C. saccharolyticum group species are still missing in the literature. First isolation of Clostridium indolis in a patient with ... - ResearchGate https://www.researchgate.net/.../305988992_First_isolation_of_Clostridium_indolis_in_a... Jan 30, 2017 - ... in a patient with chronic osteitis: A case report and literature review of human infections related to Clostridium saccharolyticum group species ... Cefepime/ciprofloxacin link.springer.com/content/pdf/10.1007/s40278-016-21617-5.pdf by R Lotte - 2016 - Related articles Oct 1, 2016 - Clostridium indolis infection: case report. An adult ... Clostridium indolis DSM. 755T was ... osteitis: a case report and literature review of human infections related to. Clostridium saccharolyticum group species. Anaerobe 42: ... First isolation of Clostridium indolis in a patient with ... - Faculty of 1000 f1000.com/prime/pubmed/ref/27510569 Aug 7, 2016 - ... in a patient with chronic osteitis: a case report and literature review of human infections related to Clostridium saccharolyticum group species. First isolation of Clostridium indolis in a patient with chronic ... - INFONA https://www.infona.pl/.../bwmeta1.element.elsevier-43cf626b-06fe-3117-a7d1-abed6... by R Lotte - 2016 - Cited by 1 - Related articles We describe the first case of osteitis related to C. indolis, identified by MALDI-TOF mass spectrometry and provide a literature review of human infections related to C. saccharolyticum group species. ... First isolation of Clostridium indolis in a patient with chronic osteitis: a case report… Romain LOTTE - Citazioni di Google Scholar scholar.google.it/citations?user=TTLtcDoAAAAJ&hl=it Translate this page INSERM U1065, Nice France & Nice Teaching Hospital Microbiology - chu-nice.fr Infections related to Actinotignum schaalii (formerly Actinobaculum schaalii): a 3-year prospective observational study on 50 cases. ... a case report and literature review of human infections related to Clostridium saccharolyticum group species.